请选择 进入手机版 | 继续访问电脑版


2020-1-20 15:30| 发布者: 人和生命| 查看: 6750| 评论: 0

摘要: SOURCE Wuhan seafood market pneumonia virus

LOCUS       MN908947               29903 bp ss-RNA     linear   VRL 17-JAN-2020
DEFINITION  Wuhan seafood market pneumonia virus isolate Wuhan-Hu-1, complete
VERSION     MN908947.3
SOURCE      Wuhan seafood market pneumonia virus
  ORGANISM  Wuhan seafood market pneumonia virus
            Viruses; Riboviria; Nidovirales; Cornidovirineae; Coronaviridae;
            Orthocoronavirinae; Betacoronavirus; unclassified Betacoronavirus.
REFERENCE   1  (bases 1 to 29903)
  AUTHORS   Wu,F., Zhao,S., Yu,B., Chen,Y.-M., Wang,W., Hu,Y., Song,Z.-G.,
            Tao,Z.-W., Tian,J.-H., Pei,Y.-Y., Yuan,M.L., Zhang,Y.-L.,
            Dai,F.-H., Liu,Y., Wang,Q.-M., Zheng,J.-J., Xu,L., Holmes,E.C. and
  TITLE     A novel coronavirus associated with a respiratory disease in Wuhan
            of Hubei province, China
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 29903)
  AUTHORS   Wu,F., Zhao,S., Yu,B., Chen,Y.-M., Wang,W., Hu,Y., Song,Z.-G.,
            Tao,Z.-W., Tian,J.-H., Pei,Y.-Y., Yuan,M.L., Zhang,Y.-L.,
            Dai,F.-H., Liu,Y., Wang,Q.-M., Zheng,J.-J., Xu,L., Holmes,E.C. and
  TITLE     Direct Submission
  JOURNAL   Submitted (05-JAN-2020) Shanghai Public Health Clinical Center &
            School of Public Health, Fudan University, Shanghai, China
COMMENT     On Jan 17, 2020 this sequence version replaced MN908947.2.
            Assembly Method       :: Megahit v. V1.1.3
            Sequencing Technology :: Illumina
FEATURES             Location/Qualifiers
     source          1..29903
                     /organism="Wuhan seafood market pneumonia virus"
                     /mol_type="genomic RNA"
                     /host="Homo sapiens"
     5'UTR           1..265
     gene            266..21555
     CDS             join(266..13468,13468..21555)
                     /note="translated by -1 ribosomal frameshift"
                     /product="orf1ab polyprotein (pp1ab)"
     gene            21563..25384
     CDS             21563..25384
                     /note="structural protein"
                     /product="surface glycoprotein"
     gene            25393..26220
     CDS             25393..26220
                     /product="ORF3a protein"
     gene            26245..26472
     CDS             26245..26472
                     /note="structural protein; E protein"
                     /product="envelope protein"
     gene            26523..27191
     CDS             26523..27191
                     /note="structural protein"
                     /product="membrane glycoprotein"
     gene            27202..27387
     CDS             27202..27387
                     /product="ORF6 protein"
     gene            27394..27759
     CDS             27394..27759
                     /product="ORF7a protein"
     gene            27894..28259
     CDS             27894..28259
                     /product="ORF8 protein"
     gene            28274..29533
     CDS             28274..29533
                     /note="structural protein"
                     /product="nucleocapsid phosphoprotein"
     gene            29558..29674
     CDS             29558..29674
                     /product="ORF10 protein"
     3'UTR           29675..29903
        1 attaaaggtt tataccttcc caggtaacaa accaaccaac tttcgatctc ttgtagatct
       61 gttctctaaa cgaactttaa aatctgtgtg gctgtcactc ggctgcatgc ttagtgcact
      121 cacgcagtat aattaataac taattactgt cgttgacagg acacgagtaa ctcgtctatc
      181 ttctgcaggc tgcttacggt ttcgtccgtg ttgcagccga tcatcagcac atctaggttt
      241 cgtccgggtg tgaccgaaag gtaagatgga gagccttgtc cctggtttca acgagaaaac
      301 acacgtccaa ctcagtttgc ctgttttaca ggttcgcgac gtgctcgtac gtggctttgg
      361 agactccgtg gaggaggtct tatcagaggc acgtcaacat cttaaagatg gcacttgtgg
      421 cttagtagaa gttgaaaaag gcgttttgcc tcaacttgaa cagccctatg tgttcatcaaacgttcggat gctcgaactg cacctcatgg tcatgttatg gttgagctgg tagcagaact
      541 cgaaggcatt cagtacggtc gtagtggtga gacacttggt gtccttgtcc ctcatgtggg
      601 cgaaatacca gtggcttacc gcaaggttct tcttcgtaag aacggtaata aaggagctgg
      661 tggccatagt tacggcgccg atctaaagtc atttgactta ggcgacgagc ttggcactga
      721 tccttatgaa gattttcaag aaaactggaa cactaaacat agcagtggtg ttacccgtga
      781 actcatgcgt gagcttaacg gaggggcata cactcgctat gtcgataaca acttctgtgg
      841 ccctgatggc taccctcttg agtgcattaa agaccttcta gcacgtgctg gtaaagcttc
      901 atgcactttg tccgaacaac tggactttat tgacactaag aggggtgtat actgctgccgtgaacatgag catgaaattg cttggtacac ggaacgttct gaaaagagct atgaattgca
     1021 gacacctttt gaaattaaat tggcaaagaa atttgacacc ttcaatgggg aatgtccaaa
     1081 ttttgtattt cccttaaatt ccataatcaa gactattcaa ccaagggttg aaaagaaaaa
     1141 gcttgatggc tttatgggta gaattcgatc tgtctatcca gttgcgtcac caaatgaatg
     1201 caaccaaatg tgcctttcaa ctctcatgaa gtgtgatcat tgtggtgaaa cttcatggca
     1261 gacgggcgat tttgttaaag ccacttgcga attttgtggc actgagaatt tgactaaaga
     1321 aggtgccact acttgtggtt acttacccca aaatgctgtt gttaaaattt attgtccagc
     1381 atgtcacaat tcagaagtag gacctgagca tagtcttgcc gaataccata atgaatctggcttgaaaacc attcttcgta agggtggtcg cactattgcc tttggaggct gtgtgttctc
     1501 ttatgttggt tgccataaca agtgtgccta ttgggttcca cgtgctagcg ctaacatagg
     1561 ttgtaaccat acaggtgttg ttggagaagg ttccgaaggt cttaatgaca accttcttga
     1621 aatactccaa aaagagaaag tcaacatcaa tattgttggt gactttaaac ttaatgaaga
     1681 gatcgccatt attttggcat ctttttctgc ttccacaagt gcttttgtgg aaactgtgaa
     1741 aggtttggat tataaagcat tcaaacaaat tgttgaatcc tgtggtaatt ttaaagttac
     1801 aaaaggaaaa gctaaaaaag gtgcctggaa tattggtgaa cagaaatcaa tactgagtcc
     1861 tctttatgca tttgcatcag aggctgctcg tgttgtacga tcaattttct cccgcactcttgaaactgct caaaattctg tgcgtgtttt acagaaggcc gctataacaa tactagatgg
     1981 aatttcacag tattcactga gactcattga tgctatgatg ttcacatctg atttggctac
     2041 taacaatcta gttgtaatgg cctacattac aggtggtgtt gttcagttga cttcgcagtg
     2101 gctaactaac atctttggca ctgtttatga aaaactcaaa cccgtccttg attggcttga
     2161 agagaagttt aaggaaggtg tagagtttct tagagacggt tgggaaattg ttaaatttat
     2221 ctcaacctgt gcttgtgaaa ttgtcggtgg acaaattgtc acctgtgcaa aggaaattaa
     2281 ggagagtgtt cagacattct ttaagcttgt aaataaattt ttggctttgt gtgctgactc
     2341 tatcattatt ggtggagcta aacttaaagc cttgaattta ggtgaaacat ttgtcacgcactcaaaggga ttgtacagaa agtgtgttaa atccagagaa gaaactggcc tactcatgcc
     2461 tctaaaagcc ccaaaagaaa ttatcttctt agagggagaa acacttccca cagaagtgtt
     2521 aacagaggaa gttgtcttga aaactggtga tttacaacca ttagaacaac ctactagtga
     2581 agctgttgaa gctccattgg ttggtacacc agtttgtatt aacgggctta tgttgctcga
     2641 aatcaaagac acagaaaagt actgtgccct tgcacctaat atgatggtaa caaacaatac
     2701 cttcacactc aaaggcggtg caccaacaaa ggttactttt ggtgatgaca ctgtgataga
     2761 agtgcaaggt tacaagagtg tgaatatcac ttttgaactt gatgaaagga ttgataaagt
     2821 acttaatgag aagtgctctg cctatacagt tgaactcggt acagaagtaa atgagttcgc
     2881 ctgtgttgtg gcagatgctg tcataaaaac tttgcaacca gtatctgaat tacttacacc
     2941 actgggcatt gatttagatg agtggagtat ggctacatac tacttatttg atgagtctgg
     3001 tgagtttaaa ttggcttcac atatgtattg ttctttctac cctccagatg aggatgaaga
     3061 agaaggtgat tgtgaagaag aagagtttga gccatcaact caatatgagt atggtactga
     3121 agatgattac caaggtaaac ctttggaatt tggtgccact tctgctgctc ttcaacctga
     3181 agaagagcaa gaagaagatt ggttagatga tgatagtcaa caaactgttg gtcaacaaga
     3241 cggcagtgag gacaatcaga caactactat tcaaacaatt gttgaggttc aacctcaatt
     3301 agagatggaa cttacaccag ttgttcagac tattgaagtg aatagtttta gtggttattt
     3361 aaaacttact gacaatgtat acattaaaaa tgcagacatt gtggaagaag ctaaaaaggt
     3421 aaaaccaaca gtggttgtta atgcagccaa tgtttacctt aaacatggag gaggtgttgc
     3481 aggagcctta aataaggcta ctaacaatgc catgcaagtt gaatctgatg attacatagc
     3541 tactaatgga ccacttaaag tgggtggtag ttgtgtttta agcggacaca atcttgctaa
     3601 acactgtctt catgttgtcg gcccaaatgt taacaaaggt gaagacattc aacttcttaa
     3661 gagtgcttat gaaaatttta atcagcacga agttctactt gcaccattat tatcagctgg
     3721 tatttttggt gctgacccta tacattcttt aagagtttgt gtagatactg ttcgcacaaa
     3781 tgtctactta gctgtctttg ataaaaatct ctatgacaaa cttgtttcaa gctttttgga
     3841 aatgaagagt gaaaagcaag ttgaacaaaa gatcgctgag attcctaaag aggaagttaa
     3901 gccatttata actgaaagta aaccttcagt tgaacagaga aaacaagatg ataagaaaat
     3961 caaagcttgt gttgaagaag ttacaacaac tctggaagaa actaagttcc tcacagaaaa
     4021 cttgttactt tatattgaca ttaatggcaa tcttcatcca gattctgcca ctcttgttag
     4081 tgacattgac atcactttct taaagaaaga tgctccatat atagtgggtg atgttgttca
     4141 agagggtgtt ttaactgctg tggttatacc tactaaaaag gctggtggca ctactgaaat
     4201 gctagcgaaa gctttgagaa aagtgccaac agacaattat ataaccactt acccgggtca
     4261 gggtttaaat ggttacactg tagaggaggc aaagacagtg cttaaaaagt gtaaaagtgccttttacatt ctaccatcta ttatctctaa tgagaagcaa gaaattcttg gaactgtttc
     4381 ttggaatttg cgagaaatgc ttgcacatgc agaagaaaca cgcaaattaa tgcctgtctg
     4441 tgtggaaact aaagccatag tttcaactat acagcgtaaa tataagggta ttaaaataca
     4501 agagggtgtg gttgattatg gtgctagatt ttacttttac accagtaaaa caactgtagc
     4561 gtcacttatc aacacactta acgatctaaa tgaaactctt gttacaatgc cacttggcta
     4621 tgtaacacat ggcttaaatt tggaagaagc tgctcggtat atgagatctc tcaaagtgcc
     4681 agctacagtt tctgtttctt cacctgatgc tgttacagcg tataatggtt atcttacttc
     4741 ttcttctaaa acacctgaag aacattttat tgaaaccatc tcacttgctg gttcctataa
     4801 agattggtcc tattctggac aatctacaca actaggtata gaatttctta agagaggtga
     4861 taaaagtgta tattacacta gtaatcctac cacattccac ctagatggtg aagttatcac
     4921 ctttgacaat cttaagacac ttctttcttt gagagaagtg aggactatta aggtgtttac
     4981 aacagtagac aacattaacc tccacacgca agttgtggac atgtcaatga catatggaca
     5041 acagtttggt ccaacttatt tggatggagc tgatgttact aaaataaaac ctcataattc
     5101 acatgaaggt aaaacatttt atgttttacc taatgatgac actctacgtg ttgaggcttt
     5161 tgagtactac cacacaactg atcctagttt tctgggtagg tacatgtcag cattaaatca
     5221 cactaaaaag tggaaatacc cacaagttaa tggtttaact tctattaaat gggcagataa
     5281 caactgttat cttgccactg cattgttaac actccaacaa atagagttga agtttaatcc
     5341 acctgctcta caagatgctt attacagagc aagggctggt gaagctgcta acttttgtgc
     5401 acttatctta gcctactgta ataagacagt aggtgagtta ggtgatgtta gagaaacaat
     5461 gagttacttg tttcaacatg ccaatttaga ttcttgcaaa agagtcttga acgtggtgtg
     5521 taaaacttgt ggacaacagc agacaaccct taagggtgta gaagctgtta tgtacatggg
     5581 cacactttct tatgaacaat ttaagaaagg tgttcagata ccttgtacgt gtggtaaaca
     5641 agctacaaaa tatctagtac aacaggagtc accttttgtt atgatgtcag caccacctgc
     5701 tcagtatgaa cttaagcatg gtacatttac ttgtgctagt gagtacactg gtaattacca
     5761 gtgtggtcac tataaacata taacttctaa agaaactttg tattgcatag acggtgcttt
     5821 acttacaaag tcctcagaat acaaaggtcc tattacggat gttttctaca aagaaaacag
     5881 ttacacaaca accataaaac cagttactta taaattggat ggtgttgttt gtacagaaat
     5941 tgaccctaag ttggacaatt attataagaa agacaattct tatttcacag agcaaccaat
     6001 tgatcttgta ccaaaccaac catatccaaa cgcaagcttc gataatttta agtttgtatg
     6061 tgataatatc aaatttgctg atgatttaaa ccagttaact ggttataaga aacctgcttc
     6121 aagagagctt aaagttacat ttttccctga cttaaatggt gatgtggtgg ctattgatta
     6181 taaacactac acaccctctt ttaagaaagg agctaaattg ttacataaac ctattgtttg
     6241 gcatgttaac aatgcaacta ataaagccac gtataaacca aatacctggt gtatacgttg
     6301 tctttggagc acaaaaccag ttgaaacatc aaattcgttt gatgtactga agtcagagga
     6361 cgcgcaggga atggataatc ttgcctgcga agatctaaaa ccagtctctg aagaagtagt
     6421 ggaaaatcct accatacaga aagacgttct tgagtgtaat gtgaaaacta ccgaagttgt
     6481 aggagacatt atacttaaac cagcaaataa tagtttaaaa attacagaag aggttggcca
     6541 cacagatcta atggctgctt atgtagacaa ttctagtctt actattaaga aacctaatga
     6601 attatctaga gtattaggtt tgaaaaccct tgctactcat ggtttagctg ctgttaatag
     6661 tgtcccttgg gatactatag ctaattatgc taagcctttt cttaacaaag ttgttagtac
     6721 aactactaac atagttacac ggtgtttaaa ccgtgtttgt actaattata tgccttattt
     6781 ctttacttta ttgctacaat tgtgtacttt tactagaagt acaaattcta gaattaaagc
     6841 atctatgccg actactatag caaagaatac tgttaagagt gtcggtaaat tttgtctaga
     6901 ggcttcattt aattatttga agtcacctaa tttttctaaa ctgataaata ttataatttg
     6961 gtttttacta ttaagtgttt gcctaggttc tttaatctac tcaaccgctg ctttaggtgt
     7021 tttaatgtct aatttaggca tgccttctta ctgtactggt tacagagaag gctatttgaa
     7081 ctctactaat gtcactattg caacctactg tactggttct ataccttgta gtgtttgtct
     7141 tagtggttta gattctttag acacctatcc ttctttagaa actatacaaa ttaccatttc
     7201 atcttttaaa tgggatttaa ctgcttttgg cttagttgca gagtggtttt tggcatatat
     7261 tcttttcact aggtttttct atgtacttgg attggctgca atcatgcaat tgtttttcag
     7321 ctattttgca gtacatttta ttagtaattc ttggcttatg tggttaataa ttaatcttgt
     7381 acaaatggcc ccgatttcag ctatggttag aatgtacatc ttctttgcat cattttatta
     7441 tgtatggaaa agttatgtgc atgttgtaga cggttgtaat tcatcaactt gtatgatgtg
     7501 ttacaaacgt aatagagcaa caagagtcga atgtacaact attgttaatg gtgttagaag
     7561 gtccttttat gtctatgcta atggaggtaa aggcttttgc aaactacaca attggaattg
     7621 tgttaattgt gatacattct gtgctggtag tacatttatt agtgatgaag ttgcgagagacttgtcacta cagtttaaaa gaccaataaa tcctactgac cagtcttctt acatcgttga
     7741 tagtgttaca gtgaagaatg gttccatcca tctttacttt gataaagctg gtcaaaagac
     7801 ttatgaaaga cattctctct ctcattttgt taacttagac aacctgagag ctaataacac
     7861 taaaggttca ttgcctatta atgttatagt ttttgatggt aaatcaaaat gtgaagaatc
     7921 atctgcaaaa tcagcgtctg tttactacag tcagcttatg tgtcaaccta tactgttact
     7981 agatcaggca ttagtgtctg atgttggtga tagtgcggaa gttgcagtta aaatgtttga
     8041 tgcttacgtt aatacgtttt catcaacttt taacgtacca atggaaaaac tcaaaacact
     8101 agttgcaact gcagaagctg aacttgcaaa gaatgtgtcc ttagacaatg tcttatctacttttatttca gcagctcggc aagggtttgt tgattcagat gtagaaacta aagatgttgt
     8221 tgaatgtctt aaattgtcac atcaatctga catagaagtt actggcgata gttgtaataa
     8281 ctatatgctc acctataaca aagttgaaaa catgacaccc cgtgaccttg gtgcttgtat
     8341 tgactgtagt gcgcgtcata ttaatgcgca ggtagcaaaa agtcacaaca ttgctttgat
     8401 atggaacgtt aaagatttca tgtcattgtc tgaacaacta cgaaaacaaa tacgtagtgc
     8461 tgctaaaaag aataacttac cttttaagtt gacatgtgca actactagac aagttgttaa
     8521 tgttgtaaca acaaagatag cacttaaggg tggtaaaatt gttaataatt ggttgaagca
     8581 gttaattaaa gttacacttg tgttcctttt tgttgctgct attttctatt taataacacctgttcatgtc atgtctaaac atactgactt ttcaagtgaa atcataggat acaaggctat
     8701 tgatggtggt gtcactcgtg acatagcatc tacagatact tgttttgcta acaaacatgc
     8761 tgattttgac acatggttta gccagcgtgg tggtagttat actaatgaca aagcttgccc
     8821 attgattgct gcagtcataa caagagaagt gggttttgtc gtgcctggtt tgcctggcac
     8881 gatattacgc acaactaatg gtgacttttt gcatttctta cctagagttt ttagtgcagt
     8941 tggtaacatc tgttacacac catcaaaact tatagagtac actgactttg caacatcagc
     9001 ttgtgttttg gctgctgaat gtacaatttt taaagatgct tctggtaagc cagtaccata
     9061 ttgttatgat accaatgtac tagaaggttc tgttgcttat gaaagtttac gccctgacac
     9121 acgttatgtg ctcatggatg gctctattat tcaatttcct aacacctacc ttgaaggttc
     9181 tgttagagtg gtaacaactt ttgattctga gtactgtagg cacggcactt gtgaaagatc
     9241 agaagctggt gtttgtgtat ctactagtgg tagatgggta cttaacaatg attattacag
     9301 atctttacca ggagttttct gtggtgtaga tgctgtaaat ttacttacta atatgtttac
     9361 accactaatt caacctattg gtgctttgga catatcagca tctatagtag ctggtggtat
     9421 tgtagctatc gtagtaacat gccttgccta ctattttatg aggtttagaa gagcttttgg
     9481 tgaatacagt catgtagttg cctttaatac tttactattc cttatgtcat tcactgtact
     9541 ctgtttaaca ccagtttact cattcttacc tggtgtttat tctgttattt acttgtactt
     9601 gacattttat cttactaatg atgtttcttt tttagcacat attcagtgga tggttatgtt
     9661 cacaccttta gtacctttct ggataacaat tgcttatatc atttgtattt ccacaaagca
     9721 tttctattgg ttctttagta attacctaaa gagacgtgta gtctttaatg gtgtttcctt
     9781 tagtactttt gaagaagctg cgctgtgcac ctttttgtta aataaagaaa tgtatctaaa
     9841 gttgcgtagt gatgtgctat tacctcttac gcaatataat agatacttag ctctttataa
     9901 taagtacaag tattttagtg gagcaatgga tacaactagc tacagagaag ctgcttgttg
     9961 tcatctcgca aaggctctca atgacttcag taactcaggt tctgatgttc tttaccaacc
    10021 accacaaacc tctatcacct cagctgtttt gcagagtggt tttagaaaaa tggcattccc
    10081 atctggtaaa gttgagggtt gtatggtaca agtaacttgt ggtacaacta cacttaacgg
    10141 tctttggctt gatgacgtag tttactgtcc aagacatgtg atctgcacct ctgaagacat
    10201 gcttaaccct aattatgaag atttactcat tcgtaagtct aatcataatt tcttggtaca
    10261 ggctggtaat gttcaactca gggttattgg acattctatg caaaattgtg tacttaagct
    10321 taaggttgat acagccaatc ctaagacacc taagtataag tttgttcgca ttcaaccagg
    10381 acagactttt tcagtgttag cttgttacaa tggttcacca tctggtgttt accaatgtgc
    10441 tatgaggccc aatttcacta ttaagggttc attccttaat ggttcatgtg gtagtgttgg
    10501 ttttaacata gattatgact gtgtctcttt ttgttacatg caccatatgg aattaccaactggagttcat gctggcacag acttagaagg taacttttat ggaccttttg ttgacaggca
    10621 aacagcacaa gcagctggta cggacacaac tattacagtt aatgttttag cttggttgta
    10681 cgctgctgtt ataaatggag acaggtggtt tctcaatcga tttaccacaa ctcttaatga
    10741 ctttaacctt gtggctatga agtacaatta tgaacctcta acacaagacc atgttgacat
    10801 actaggacct ctttctgctc aaactggaat tgccgtttta gatatgtgtg cttcattaaa
    10861 agaattactg caaaatggta tgaatggacg taccatattg ggtagtgctt tattagaaga
    10921 tgaatttaca ccttttgatg ttgttagaca atgctcaggt gttactttcc aaagtgcagt
    10981 gaaaagaaca atcaagggta cacaccactg gttgttactc acaattttga cttcactttt
    11041 agttttagtc cagagtactc aatggtcttt gttctttttt ttgtatgaaa atgccttttt
    11101 accttttgct atgggtatta ttgctatgtc tgcttttgca atgatgtttg tcaaacataa
    11161 gcatgcattt ctctgtttgt ttttgttacc ttctcttgcc actgtagctt attttaatat
    11221 ggtctatatg cctgctagtt gggtgatgcg tattatgaca tggttggata tggttgatac
    11281 tagtttgtct ggttttaagc taaaagactg tgttatgtat gcatcagctg tagtgttact
    11341 aatccttatg acagcaagaa ctgtgtatga tgatggtgct aggagagtgt ggacacttat
    11401 gaatgtcttg acactcgttt ataaagttta ttatggtaat gctttagatc aagccatttc
    11461 catgtgggct cttataatct ctgttacttc taactactca ggtgtagtta caactgtcat
    11521 gtttttggcc agaggtattg tttttatgtg tgttgagtat tgccctattt tcttcataac
    11581 tggtaataca cttcagtgta taatgctagt ttattgtttc ttaggctatt tttgtacttg
    11641 ttactttggc ctcttttgtt tactcaaccg ctactttaga ctgactcttg gtgtttatga
    11701 ttacttagtt tctacacagg agtttagata tatgaattca cagggactac tcccacccaa
    11761 gaatagcata gatgccttca aactcaacat taaattgttg ggtgttggtg gcaaaccttg
    11821 tatcaaagta gccactgtac agtctaaaat gtcagatgta aagtgcacat cagtagtctt
    11881 actctcagtt ttgcaacaac tcagagtaga atcatcatct aaattgtggg ctcaatgtgt
    11941 ccagttacac aatgacattc tcttagctaa agatactact gaagcctttg aaaaaatggt
    12001 ttcactactt tctgttttgc tttccatgca gggtgctgta gacataaaca agctttgtga
    12061 agaaatgctg gacaacaggg caaccttaca agctatagcc tcagagttta gttcccttcc
    12121 atcatatgca gcttttgcta ctgctcaaga agcttatgag caggctgttg ctaatggtga
    12181 ttctgaagtt gttcttaaaa agttgaagaa gtctttgaat gtggctaaat ctgaatttga
    12241 ccgtgatgca gccatgcaac gtaagttgga aaagatggct gatcaagcta tgacccaaat
    12301 gtataaacag gctagatctg aggacaagag ggcaaaagtt actagtgcta tgcagacaat
    12361 gcttttcact atgcttagaa agttggataa tgatgcactc aacaacatta tcaacaatgc
    12421 aagagatggt tgtgttccct tgaacataat acctcttaca acagcagcca aactaatggttgtcatacca gactataaca catataaaaa tacgtgtgat ggtacaacat ttacttatgc
    12541 atcagcattg tgggaaatcc aacaggttgt agatgcagat agtaaaattg ttcaacttag
    12601 tgaaattagt atggacaatt cacctaattt agcatggcct cttattgtaa cagctttaag
    12661 ggccaattct gctgtcaaat tacagaataa tgagcttagt cctgttgcac tacgacagat
    12721 gtcttgtgct gccggtacta cacaaactgc ttgcactgat gacaatgcgt tagcttacta
    12781 caacacaaca aagggaggta ggtttgtact tgcactgtta tccgatttac aggatttgaa
    12841 atgggctaga ttccctaaga gtgatggaac tggtactatc tatacagaac tggaaccacc
    12901 ttgtaggttt gttacagaca cacctaaagg tcctaaagtg aagtatttat actttattaaaggattaaac aacctaaata gaggtatggt acttggtagt ttagctgcca cagtacgtct
    13021 acaagctggt aatgcaacag aagtgcctgc caattcaact gtattatctt tctgtgcttt
    13081 tgctgtagat gctgctaaag cttacaaaga ttatctagct agtgggggac aaccaatcac
    13141 taattgtgtt aagatgttgt gtacacacac tggtactggt caggcaataa cagttacacc
    13201 ggaagccaat atggatcaag aatcctttgg tggtgcatcg tgttgtctgt actgccgttg
    13261 ccacatagat catccaaatc ctaaaggatt ttgtgactta aaaggtaagt atgtacaaat
    13321 acctacaact tgtgctaatg accctgtggg ttttacactt aaaaacacag tctgtaccgt
    13381 ctgcggtatg tggaaaggtt atggctgtag ttgtgatcaa ctccgcgaac ccatgcttcagtcagctgat gcacaatcgt ttttaaacgg gtttgcggtg taagtgcagc ccgtcttaca
    13501 ccgtgcggca caggcactag tactgatgtc gtatacaggg cttttgacat ctacaatgat
    13561 aaagtagctg gttttgctaa attcctaaaa actaattgtt gtcgcttcca agaaaaggac
    13621 gaagatgaca atttaattga ttcttacttt gtagttaaga gacacacttt ctctaactac
    13681 caacatgaag aaacaattta taatttactt aaggattgtc cagctgttgc taaacatgac
    13741 ttctttaagt ttagaataga cggtgacatg gtaccacata tatcacgtca acgtcttact
    13801 aaatacacaa tggcagacct cgtctatgct ttaaggcatt ttgatgaagg taattgtgac
    13861 acattaaaag aaatacttgt cacatacaat tgttgtgatg atgattattt caataaaaaggactggtatg attttgtaga aaacccagat atattacgcg tatacgccaa cttaggtgaa
    13981 cgtgtacgcc aagctttgtt aaaaacagta caattctgtg atgccatgcg aaatgctggt
    14041 attgttggtg tactgacatt agataatcaa gatctcaatg gtaactggta tgatttcggt
    14101 gatttcatac aaaccacgcc aggtagtgga gttcctgttg tagattctta ttattcattg
    14161 ttaatgccta tattaacctt gaccagggct ttaactgcag agtcacatgt tgacactgac
    14221 ttaacaaagc cttacattaa gtgggatttg ttaaaatatg acttcacgga agagaggtta
    14281 aaactctttg accgttattt taaatattgg gatcagacat accacccaaa ttgtgttaac
    14341 tgtttggatg acagatgcat tctgcattgt gcaaacttta atgttttatt ctctacagtg
    14401 ttcccaccta caagttttgg accactagtg agaaaaatat ttgttgatgg tgttccattt
    14461 gtagtttcaa ctggatacca cttcagagag ctaggtgttg tacataatca ggatgtaaac
    14521 ttacatagct ctagacttag ttttaaggaa ttacttgtgt atgctgctga ccctgctatg
    14581 cacgctgctt ctggtaatct attactagat aaacgcacta cgtgcttttc agtagctgca
    14641 cttactaaca atgttgcttt tcaaactgtc aaacccggta attttaacaa agacttctat
    14701 gactttgctg tgtctaaggg tttctttaag gaaggaagtt ctgttgaatt aaaacacttc
    14761 ttctttgctc aggatggtaa tgctgctatc agcgattatg actactatcg ttataatcta
    14821 ccaacaatgt gtgatatcag acaactacta tttgtagttg aagttgttga taagtacttt
    14881 gattgttacg atggtggctg tattaatgct aaccaagtca tcgtcaacaa cctagacaaa
    14941 tcagctggtt ttccatttaa taaatggggt aaggctagac tttattatga ttcaatgagt
    15001 tatgaggatc aagatgcact tttcgcatat acaaaacgta atgtcatccc tactataact
    15061 caaatgaatc ttaagtatgc cattagtgca aagaatagag ctcgcaccgt agctggtgtc
    15121 tctatctgta gtactatgac caatagacag tttcatcaaa aattattgaa atcaatagcc
    15181 gccactagag gagctactgt agtaattgga acaagcaaat tctatggtgg ttggcacaac
    15241 atgttaaaaa ctgtttatag tgatgtagaa aaccctcacc ttatgggttg ggattatcct
    15301 aaatgtgata gagccatgcc taacatgctt agaattatgg cctcacttgt tcttgctcgcaaacatacaa cgtgttgtag cttgtcacac cgtttctata gattagctaa tgagtgtgct
    15421 caagtattga gtgaaatggt catgtgtggc ggttcactat atgttaaacc aggtggaacc
    15481 tcatcaggag atgccacaac tgcttatgct aatagtgttt ttaacatttg tcaagctgtc
    15541 acggccaatg ttaatgcact tttatctact gatggtaaca aaattgccga taagtatgtc
    15601 cgcaatttac aacacagact ttatgagtgt ctctatagaa atagagatgt tgacacagac
    15661 tttgtgaatg agttttacgc atatttgcgt aaacatttct caatgatgat actctctgac
    15721 gatgctgttg tgtgtttcaa tagcacttat gcatctcaag gtctagtggc tagcataaag
    15781 aactttaagt cagttcttta ttatcaaaac aatgttttta tgtctgaagc aaaatgttgg
    15841 actgagactg accttactaa aggacctcat gaattttgct ctcaacatac aatgctagtt
    15901 aaacagggtg atgattatgt gtaccttcct tacccagatc catcaagaat cctaggggcc
    15961 ggctgttttg tagatgatat cgtaaaaaca gatggtacac ttatgattga acggttcgtg
    16021 tctttagcta tagatgctta cccacttact aaacatccta atcaggagta tgctgatgtc
    16081 tttcatttgt acttacaata cataagaaag ctacatgatg agttaacagg acacatgtta
    16141 gacatgtatt ctgttatgct tactaatgat aacacttcaa ggtattggga acctgagttt
    16201 tatgaggcta tgtacacacc gcatacagtc ttacaggctg ttggggcttg tgttctttgc
    16261 aattcacaga cttcattaag atgtggtgct tgcatacgta gaccattctt atgttgtaaatgctgttacg accatgtcat atcaacatca cataaattag tcttgtctgt taatccgtat
    16381 gtttgcaatg ctccaggttg tgatgtcaca gatgtgactc aactttactt aggaggtatg
    16441 agctattatt gtaaatcaca taaaccaccc attagttttc cattgtgtgc taatggacaa
    16501 gtttttggtt tatataaaaa tacatgtgtt ggtagcgata atgttactga ctttaatgca
    16561 attgcaacat gtgactggac aaatgctggt gattacattt tagctaacac ctgtactgaa
    16621 agactcaagc tttttgcagc agaaacgctc aaagctactg aggagacatt taaactgtct
    16681 tatggtattg ctactgtacg tgaagtgctg tctgacagag aattacatct ttcatgggaa
    16741 gttggtaaac ctagaccacc acttaaccga aattatgtct ttactggtta tcgtgtaactaaaaacagta aagtacaaat aggagagtac acctttgaaa aaggtgacta tggtgatgct
    16861 gttgtttacc gaggtacaac aacttacaaa ttaaatgttg gtgattattt tgtgctgaca
    16921 tcacatacag taatgccatt aagtgcacct acactagtgc cacaagagca ctatgttaga
    16981 attactggct tatacccaac actcaatatc tcagatgagt tttctagcaa tgttgcaaat
    17041 tatcaaaagg ttggtatgca aaagtattct acactccagg gaccacctgg tactggtaag
    17101 agtcattttg ctattggcct agctctctac tacccttctg ctcgcatagt gtatacagct
    17161 tgctctcatg ccgctgttga tgcactatgt gagaaggcat taaaatattt gcctatagat



